Теоретическое и экспериментальное обоснование методов ДНК-анализа для оценки генетического материала голштинской породы КРС

Theoretical and experimental substantiation of methods of DNA-analysis to assess the genetic material of the Holstein breed of cattle


УДК 636.2.034

18.08.2017
 119

Выходные сведения:
Филипенкова Г.В., Делян А.С., Светличкин В.В. Теоретическое и экспериментальное обоснование методов ДНК-анализа для оценки генетического материала голштинской породы КРС // Аэкономика: экономика и сельское хозяйство, 2017. №8 (20). URL: http://aeconomy.ru/science/agro/teoreticheskoe-i-eksperimentalnoe-o/

Авторы:
Филипенкова Г.В.1, Делян А.С.1, Светличкин В.В.2

1 студент магистратуры кафедры «Разведения животных технологии производства и переработки продукции животноводства», ФГБОУ ВО «Российский государственный аграрный заочный университет», Московская область, Российская Федерация (143907, г. Балашиха, Московской области ул. Ш. Энтузиастов, д. 50), e-mail:galinka0070@mail.ru

1 д.с.-х.н., профессор, декан Зооинженерного факультета, ФГБОУ ВО «Российский государственный аграрный заочный университет», Московская область, Российская Федерация (143907, г. Балашиха, Московской области ул. Ш. Энтузиастов, д. 50), zooing@rgazu.ru

2 д.б.н., профессор, Заведующий лабораторией технического регулирования и стандартизации, ФГБНУ «Всероссийского научно-исследовательского института ветеринарной санитарии, гигиены и экологии», Москва, Российская Федерация (123022, Москва, Звенигородское шоссе, д. 5), svetl.bbc@yandex.ru

Authors:
Filipenkova G.V.1, Delyan A.S.1, Svetlichkin V.V.2

1 a graduate student of the Department "Animal Husbandry Production Technology and Processing of Livestock Products", of the "Russian State Agrarian Correspondence University", Moskovskaya oblast, Russian Federation (143907, Balashikha, Moscow region, St. sh. Entuziastov, d. 50), e-mail:galinka0070@mail.ru

1 D. S.-agricultural Sciences, Professor, Dean of Zooengineering faculty of the "Russian State Agrarian Correspondence University", Moskovskaya oblast, Russian Federation (143907, Balashikha, Moscow region, St. sh. Entuziastov, d. 50), zooing@rgazu.ru

2 d.b.n., Professor, Head of laboratory of technical regulation and standardization, FEDERAL state scientific institution "All-Russian research Institute of Veterinary Sanitation, Hygiene and Ecology", Moscow, Russian Federation (123022, Moscow, Zvenigorodsky highway, d. 5), svetl.bbc@yandex.ru

Ключевые слова:
генотип, голштинская порода, комплекс аномалий позвоночника, дефицит лейкоцитарной адгезии, ПЦР в режиме реального времени, ДНК-маркеры, аномалии

Keyword:
genotype, Holstein breed, Complex Vertebral Malformation (CVM), Leukocyte Adhesion Deficiency (LAD), PCR in real time, DNA markers, anomalies

Аннотация: 
В статье рассмотрены вопросы оценки особей голштинской породы крупного рогатого скота на содержание дефектных генов, вызывающих комплекс аномалий позвоночника (CVM - Complex Vertebral Malform) и дефицит лейкоцитарной адгезии, сопровождающийся отставанием в росте, воспалением лёгких, кишечного тракта, гортани, дёсен, частичным выпадением зубов, чувствительностью к бактериальным и грибковым инфекциям и наносящих значительный ущерб животноводству и экономики сельского хозяйства в целом. Проведенными исследованиями с использованием набора реагентов фирмы «Синтол» для реакции ПЦР в режиме «реального времени» по определению сайтов ДНК «CVM-BLAD» для выявления сайтов ДНК комплексной аномалии позвоночника и дефицита лейкоцитарной адгезии у крупного рогатого скота отработаны методики выделения матричных ДНК из проб (крови и молока). С помощью роботизированного прибора Qiagen EZ1 Advanced XL валидированы условия ПЦР для термоциклера «Mastercycler epgradient S eppendorf realpleax2». Показана также возможность выявления дефектных генов с применением ДНК-чипов и калориметрической детекцией конечного результата. Использована методика ДНК-чипов с гибридизацией на мембранных носителях с меченными в процессе реакции амплификации ДНК-маркерами и последующей калориметрической детекцией результата. С помощью указанных методов в некоторых пробах были обнаружены дефектные гены, показана корреляция методов. Методика на основе ПЦР в режиме реального времени (Real time PCR) по определению сайтов ДНК «CVM-BLAD» для выявления комплексной аномалии позвоночника и дефицита лейкоцитарной адгезии у крупного рогатого скота оказалась более чувствительной.

Annotation: 
In the article the questions of evaluation of the individuals of Holstein breed of cattle for the maintenance of defective genes that cause complex abnormalities of the spine (CVM - Complex Vertebral Malform) and deficiency of leukocyte adhesion, accompanied by stunted growth, inflammation of the lungs, gastrointestinal tract, larynx, gums, partial tooth loss, sensitivity to bacterial and fungal infections and cause significant damage to farming and the rural economy as a whole. Studies using a set of reagents firm "Synthol" reaction in a PCR in "real time" by definition sites of DNA "CVM-BLAD" to identify sites of DNA complex anomalies of the spine and deficiency of leukocyte adhesion in cattle developed methods of extraction of matrix DNA from samples (blood and milk). With the use of a robotic device of the Qiagen EZ1 Advanced XL validated the PCR conditions for thermal cycler "Mastercycler epgradient S eppendorf realpleax2". It also allows to identify the defective gene using DNA chips and calorimetric detection of the end result. The technique used for the DNA chip by hybridization on membrane carriers labeled during the reaction of amplification of DNA markers and subsequent calorimetric detection result. Using these methods in some samples it was discovered faulty genes demonstrated the correlation methods. The technique is based on PCR in real time (Real time PCR) to determine the sites of DNA "CVM-BLAD" for detecting complex vertebral anomalies and deficiency of leukocyte adhesion in cattle proved to be more sensitive.

Теоретическое и экспериментальное  обоснование методов ДНК-анализа для оценки генетического материала  голштинской породы КРС


Введение

Разведение различных пород КРС, включая голштинскую, является сложной системой, состоящей из зоотехнических, ветеринарных, зоогигиенических, ветеринарно-санитарных и других мероприятий. При этом необходимо учитывать генетические, физиологические, половые и возрастные характеристики животных, особенности их кормления, содержания, предрасположенность к болезням [22, 23]. Важным является регион разведения и особенности сельскохозяйственного производства (фермы, частные подворья, крупные племенные хозяйства) и другие факторы.

При разведении КРС существенную роль играют различные генетические аномалии. В племенном деле для корректирующей селекции важной проблемой является контроль генетических дефектов у крупного рогатого скота [Эрнст Л.К., Жигачева А.И. Кудрявцев В.А. «Мониторинг генетического груза в черно-пестрой, голштинской и айрширской породах крупного рогатого скота». Зоотехния, 2007, № 3, с. 5-10].

Среди этих дефектов следует отметить комплексную аномалию позвоночника КРС (CVM - Complex Vertebral Malformation). Это сложный тератологический синдром телят голштинской породы, проявляющийся, прежде всего, в абортах, преждевременных родах, мертворождении или смерти телят в первые дни жизни, а, значит, воздействующий на смертность молодняка и воспроизводительные способности скота. Возникновение данного синдрома обусловлено аутосомной рецессивной мутацией SLC35A3 - гена и явлением плейотропии, при котором этот ген вызывает резкие отклонения от нормального хода развития и множественные аномалии.

К другим, немаловажным генетическим дефекта, можно отнести дефицит лейкоцитарной адгезии КРС. Проявления заболевания - отставание в росте, воспаления лёгки, кишечного тракта, гортани, дёсен, частичное выпадение зубов. Заболевание является наследственным, аутосомно-рецессивным и сопровождается высокой чувствительностью к бактериальным и грибковым инфекциям.

Для объективной характеристики особей необходимо проводить их генетическую оценку  с применением современных методов и средств.

Для этих целей перспективными являются методы ДНК- анализа.

В настоящее время разработаны тест-системы на основе ПЦР в режиме реального времени (Real time PCR) для диагностики указанных выше генетических дефектов. Однако, для реализации ее для конкретных объектов, необходимо проводить валидацию и верификацию тест-системы.

Актуальным также является проведение оценки других методов ДНК-диагностики, в частности, ДНК-микрочиповой технологии и секвинирования с целью применения их при выяснении генетических дефектов КРС.

Целью нашей работы являлось проведение теоретического и экспериментального обоснования  методов ДНК-анализа для оценки генетического материала  голштинской породы КРС. В задачи исследования входило:

1. Провести выделение ДНК из крови и молока КРС и усовершенствовать методику выделения с помощью робототехники.

2. Валидировать и верифицировать тест-систему «CVM-BLAD» фирмы «Синтол» для определения комплексной аномалии позвоночника (CVM) и дефицита лейкоцитарной адгезии (BLAD) у крупного рогатого скота методом ПЦР в реальном времени.

3. Провести анализ данных по оценки генетического материала   голштинской породы КРС по определению комплексной аномалии позвоночника (CVM) и дефицита лейкоцитарной адгезии (BLAD).

4. Теоретически и экспериментально обосновать методы ДНК-чиповой  технологии для оценки генетического материала голштинской породы КРС.

Материал и методы

Исследования проводились на Зооинженерном факультете Российского Государственного Аграрного Заочного Университета (ФГБОУ ВО «РГАЗУ») под руководством доктора сельскохозяйственных наук, профессора А.С. Де-ляна, а также на базах Федерального государственного бюджетного научного учреждения «Всероссийский научно-исследовательский институт ветеринарной санитарии, гигиены и экологии» (ФГБНУ «ВНИИВСГЭ»), Всероссийского научно-исследовательского института животноводства Россельхозакаде-мии (ВИЖ  им. Л.К. Эрнста, ВНИИ животноводства).

В работе использовали набор реагентов фирмы «Синтол» для проведения ПЦР в режиме «реального времени» по определению сайтов ДНК «CVM-BLAD» для выявления сайтов ДНК комплексной аномалии позвоночника и дефицита лейкоцитарной адгезии у крупного рогатого скота.

Экспериментальные образцы ДНК-микрочиповой технологии (ФГБНУ «ВНИИВСГЭ»).

Матричную ДНК выделяли с помощью роботизированного прибора Qiagen EZ1 Advanced XL, использующего технологию магнитных частиц, термоциклир «Mastercycler epgradient S eppendorf realpleax2». 

Тест система «CVM-BLAD» и методика ПЦР в режиме «реального времени» по определению сайтов ДНК  комплексной аномалии позвоночника и дефицита лейкоцитарной адгезии у крупного рогатого скота.

Набор включал последовательности праймеров и аллель-специфических зондов, которые имеют следующую структуру: CVM_up gattctcaagagcttaattctaagga, CVM_low aagtaaaccccagcaaagccac, CVM_Wt (FAM)-aggtctcatggcagttct-(BHQ1), CVM_m (R6G)-catggcatttctcacagcat-(BHQ2), BLAD_up ttaggcagttgcgttc, BLAD_low acgttgacgaggtcatccacca, BLAD_Wt (ROX)-accccatcgacctgtacta-(BHQ1), BLAD_m (Cy5)-ccatcggcctgtactacct-(BHQ2). Предложенное изобретение позволяет одновременно диагностировать CVM и BLAD у крупного рогатого скота методом ПЦР в реальном времени, а также сократить время выполнения полимеразной цепной реакции в реальном времени.

Набор праймеров и зондов в сравнении со всеми изученными аналогами имеет следующие преимущества: специфическая структура праймеров и зондов, а также с помощью предлагаемого к патентованию набора праймеров и зондов можно одновременно в одной пробирке провести полимеразную цепную реакцию в режиме реального времени (ПЦР-РВ), что обеспечивает быстроту проведения диагностики и получение результата сразу по двум представленным мутациям.

Подбор праймеров и аллель-специфических зондов позволял при помощи пакета прикладных программ «Oligo 6.0» на основании анализа нуклеотидных последовательностей локусов SLC35A3 и CD 18 ДНК, опубликованных в базе NSBI.

Источником для проведения диагностики служила предварительно выделенная ДНК из образцов цельной крови и молока.

Результаты и обсуждение

В процессе исследований была выделен матричная ДНК из крови с использованием робототехники [1], что позволяло сократить время выделения и автоматизировать процесс.

Проведена валидация тест-системы и установлены оптимальные параметры постановки ПЦР РВ для используемого термоциклера «Mastercycler epgradient S eppendorf realpleax2». 

1. Удержание температуры 94°С - 3 мин, один повтор.

2. Циклирование 1

94°С - 25 с

61°С - 23 с

64°С - 23 с

Цикл повторяли 10 раз.

3. Циклирование 2 (с детекцией)

94°С – 25,0 с

61°С - 23 с

64°С - 30 с - детекция по каналам: Green, Yellow, Orange, Red

Цикл повторяли 30 раз.

Результатом анализа являлось определение мутантных аллелей, вызывающих комплекс аномалий позвоночника (CVM) и дефицит лейкоцитарной адгезии (BLAD) у крупного рогатого скота.

Аллель-специфические зонды эффективны при детекции CV и BL мутаций в исследуемом фрагменте генома. Для локуса с мутацией подбирают пару зондов, так чтобы один из них специфически гибридизовался при температуре проведения синтеза цепей с аллелем нормального (дикого) типа, а второй зонд - с аллелем мутантного типа.

Переход порога, характеристика количества копий ДНК отдельного гена, кривая располагалась между двумя пороговыми значениями 10 и 15 циклами амплификации.

Кривая без маркеров располагается между 10 и 15 циклами над красной пороговой линией. Вторая кривая с окружностями ниже пороговой линии. Данная ситуация характерна для здорового исследуемого животного.

Результаты исследования гетерозиготного животного или носителя мутантного CV аллеля обе кривые флуоресценции пересекали установленную на соответствующем уровне пороговую линию в обозначенном районе, между 10 и 15 циклами ПЦР-РВ.

Определение BL аллеля было аналогично, только регистрировалось по каналам Orange и Red. 

Исследования помогли выявить в трех процентах проб (всего 20) указанные генетические дефекты.

При использовании ДНК-чипов применяли ранее предложенный подход  [2] и разработана соответствующая тест- система и методика адаптированная к нашим объекта

ДНК-зонды предварительно получали в реакции амплификации с использованием выше указанных коммерческих праймеров и меченных биотином дезоксинуклеозидтрифосатами.

Выделение и очистку исследуемой ДНК проводили с помощью детергента «Silico», магнитосепарации при использовании робототехники.

 Выделенную ДНК иммобилизовали на мембранные фильтры и проводили гибридизацию с меченными ДНК-зондами.

Гибридизацию проводили с помощью тест-набора для гибридизации, который представлял собой комплект реагентов включавший: ДНК-зонд (№1), контрольный положительный образец (№2), контрольный отрицательный образец (№3), субстрат (№4), хромоген (№5), протеиназа К (№6), конъюгат (№7), раствор для гибридизации (№8), солевой раствор TS (№9), желатин 10% или сухой (№10), раствор для приготовления проявляющей смеси (№11), навеска солей для приготовления 20xССР (№12), блокирующий реагент (№13), раствор для лизиса (№14), лаурилсульфат натрия (SDS) 10% (№15), тритон Х-100 (№16), полиэтиленгликоль (№17), нитроцеллюлозный фильтр (№18).

ДНК-зонды гибридизовали с денатурированными иммобитлизованными ДНК. Не связавшиеся зонды удаляли путем отмыки чипа. На следующем этапе чип обрабатывали конъюгатом стрептавидина с щелочной фосфатазой. На заключительном этапе вносили субстратный раствор. Окрашивание соответствующих точек свидетельствовало о наличии искомой бактериальной ДНК в исследуемом материале.

Перед проведением реакции готовили рабочие растворы:

1. Раствор 20xССР. Содержимое флакона («Навеска солей для приготовления 20xССР») растворяли в 27.0 мл дистиллированной воды.

2. Раствор 10xССР. 10.0 мл раствора 20xСCР разводили в 10 мл дистиллированной воды и тщательно перемешивали.

3. Прегибридизационный раствор. К 3-м мл раствора для гибридизации добавляли 3 мл дистиллированной воды и 24 мкл раствора из микропробирки («Контрольный отрицательный образец»). Полученный раствор тщательно перемешивали.

4. Гибридизационный раствор. В 3-х мл прегибридизационного раствора растворяли содержимое флакона («Полиэтиленгликоль») и добавляли содержимое микропробирки («ДНК-зонд»), предварительно прогрев ее в кипящей водяной бане в течение 8 мин.

5. Отмывочный раствор №1. К 10 мл раствора 20xСCР добавляли 2 мл раствора из флакона («Лаурилсульфат натрия 10%») и разводили дистиллированной водой до конечного объема 100 мл. Полученный раствор тщательно перемешивали.

6. Отмывочный раствор № 2. К 1 мл раствора 20xССР добавляли 2 мл раствора из флакона («Лаурилсульфат натрия 10%») и разводили дистиллированной водой до конечного объема 100 мл. Полученный раствор тщательно перемешивали.

7. Отмывочный раствор №3. 2мл раствора 20xССР разводили дистиллированной водой до конечного объема 20 мл и тщательно перемешивали.

8. Лизирующий раствор. Добавляли содержимое пробирки («Протеиназа К») во флакон («Раствор для лизиса») и тщательно перемешивали.

9. Раствор TST. Содержимое двух флаконов («Солевой раствор TS») растворяли в 200 мл дистиллированной воды и добавляли 0.1 мл тритона Х-100.

10. Блокирующий раствор. Содержимое пробирки («Блокирующий реагент») разводили в 22 мл раствора ТST, добавляли 3 мл желатина 10% из ампулы или приготовленный из сухого желатина (1г желатина растворяли в 10 мл воды; для быстрого растворения раствор можно подогревать и тщательно перемешивать).

11. Раствор конъюгата. Из пробирки («Конъюгат») отбирали 0,002 мл раствора и вносили в 3 мл раствора TST. Поученный раствор тщательно перемешивали.

12. Для приготовления проявляющей смеси в 3 мл из флакона («Раствор для приготовления проявляющей смеси») добавляли 13,2 мкл из пробирки («Хромоген») и 9,9 мкл из пробирки («Субстрат»), (содержимое которой предварительно взмутить). Полученный раствор тщательно перемешивали.

На чип наносили ампликоны и 3 мл гибридизационного раствора. Инкубировали чип 4 часа при 65ºС в плотно закрытой чашке Петри.

Чип отмывали трехкратно по 10 мин на качалке при комнатной температуре в 30мл отмывочного раствора №1. Затем отмывали двукратно по 10 мин при температуре 65ºС в 40 мл отмывочного раствора №2. Затем отмывали однократно в течение 5 мин на качалке при комнатной температуре в 20 мл отмывочного раствора №3. Чип помещали в 25 мл блокирующего раствора и инкубировали 30 мин при 37ºС.

Для проведения реакции связывания конъюгата чип ополаскивали в 20 мл раствора TST и переносили в чашку Петри с парафильмом на дне. Наслаивали на чип сверху 3 мл раствора конъюгата и инкубировали в течение 30 мин при комнатной температуре. Чип отмывали трехкратно по 10 мин на качалке при комнатной температуре в 30 мл раствора TST и однократно – в 7 мл раствора проявляющей смеси.

Переносили чип в чашку Петри с настеленным на дно парафильмом и наслаивали сверху 3 мл проявляющей смеси. Чип инкубировали в темноте при 37ºС или при комнатной температуре в течение нескольких часов до появления окраски в пятне, содержащем контрольный положительный образец. Чип промывали в водопроводной воде для остановки проявления и высушивали.

Учет результатов проводили визуально путем сравнения интенсивности окраски пятен, содержащих анализируемый материал, с интенсивностью окраски пятна на чипе, содержащего контрольный положительный образец, которое окрашивалось в фиолетово-голубой цвет. Пятно, содержащее контрольный отрицательный образец, не окрашивалось или имело интенсивность окраски на уровне общего фона фильтра. Если эти условия не соблюдались, учет результатов не считался адекватным и тест требовал повторной постановки.

Результаты показали корреляцию с методикой ПЦР РВ.

Выводы

Проведенные исследования показали возможность анализируемых методов и тест-систем для выявления генетических дефектов голштинской породы КРС.


Библиографический список


1. Айтназаров Р.Б. Био / Р.Б. Айтназаров. - 2003. - №12(39).
2. Алтухов, Ю.П. Полиморфизм ДНК в популяционной генетике. / Ю.П. Алтухов, Е.А. Салменкова // Генетика. - 2002.- Т. 38. - № 9. - С. 1173-1195.
3. Артемов А.В. Разработка методов и средств обеспечения микробиологической безопасности объектов ветеринарного надзора: Автореферат диссертации канд. биол. наук. – Москва: ВНИИВСГЭ, 2012.
4. Богатова О. В. Современные биотехнологии в сельском хозяйстве / О.В. Богатова, Г. В. Карпова, М.Б. Ребезов, Г. М. Топурия, М. В. Клычкова, Ю. С. Кичко. – Оренбург: ОГУ, 2012. – 171 с.
5. Гончаренко Г.М. «Генетические маркеры и их значение для селекционно-племенной работы». Животноводство, 2008, № 6, с. 47-54.
6. Долгов В.А. Автоматизированный метод биотестирования продуктов животного происхождения, кормов и других объектов ветеринарно-санитарного и экологического контроля / В.А. Долгов, С.А. Лавина, Т.С. Арно, И.В. Самохин, Е.Г. Черемных // Проблемы ветеринарной санитарии, гигиены и экологии. – 2010. – № 2(4). – С. 14 – 17.
7. Зиновьева Н. Методы маркер-зависимой селекции. / Н. Зиновьева, Е. Гладырь, Г. Державина, Е. Кунаева // Животноводство России. - 2006. - № 3. - С. 29-31.
8. Иоличев, Б. С. Использование ДНК-технологий в молочном скотоводстве / Б. С.
9. Иоличев, В. И. Сельцов // ДНК-технологии в клеточной инженерии и маркировании признаков сельскохозяйственных животных : «Материалы междунар. конф.» – Дубровицы, 2001. – С. 67-70.
10. Кленовицкий П.М. Генетика и биотехнология в селекции животных / П.М. Кленовицкий, Н.С. Марзанов, В.А. Багиров, М.Г. Насибов. – М., 2004. -285 с.
11. Мамонтова, Т.В. Современные тенденции развития мирового и российского рынка биотехнологий в животноводстве / Т.В, Мамонтова, М.М. Айбазов, О. Русакова // Сборник научных трудов Всероссийского научно-исследовательского института овцеводства и козоводства. - 2014. - Т. 2. - № 7. - С. 292-300.
12. Морозова Е.Н. Совершенствование методики обнаружения сальмонелл с помощью ПЦР / Морозова Е.Н., Светличкин В.В. // Сборник трудов IV научно-практической конференции с международным участием « Молекулярная диагностика 2014», том II.- М.- 2014.- С. 407 – 408.
13. Светличкин В.В. Современное состояние гармонизация биохимических, иммунологических и молекулярно-генетических методов оценки безопасности и качества продовольственного сырья и продукции животного происхождения // Проблемы ветеринарной санитарии, гигиены и экологии: Сб. науч. тр. – Москва: ВНИИВСГЭ, 2001. – Т. 111. – С. 3-15.
14. Светличкин В.В. Тест-системы и технические средства ускоренного контроля безопасности и качества объектов ветеринарного надзора / В.В. Светличкин, А.Б. Кононенко, С.П. Ярков, А.А. Стрелков, М.В. Кондратьева, А.И. Панюшкин // Проблемы ветеринарной санитарии, гигиены и экологии : Сб. науч. тр. – Москва: ВНИИВСГЭ, 2010. – № 1. – С. 26-33.
15. Светличкин В.В., Кононенко А.Б., Ярков С.П., Стрелков А.А., Кондратьева М.В., Панюшкин А.И. / Тест-системы и технические средства ускоренного контроля безопасности и качества объектов ветеринарного надзора // Сборник ГНУ ВНИИВСГЭ «Проблемы ветеринарной санитарии, гигиены и экологии», М.: 2010, № 1, С. – 26 - 33.
16. Сердюк, Г.Н. Использование иммуногенетических маркеров в селекции животных / Г.Н. Сердюк // Современные методы генетики и селекции в животноводстве: материалы международной научной конференции С.-Петербург: ВНИИГРЖ. - 2007. - С. 240-243.
17. Серебровский, А.С. Генетический анализ. / А.С, Серебровский. - М.: Наука. - 1970.- 342 с.
18. Смарагдов, М.Г. Тотальная геномная селекция с помощью SNP как возможный ускоритель традиционной селекции / М.Г. Смарагдов // Генетика. - 2009. - Т.45. - № 6. - С. 725-728.
19. Чубарова Е.А., Кальницкая О.И., Пульчева И.А. Повышение эффективности контроля биологической безопасности молока и молочных продуктов на основе использования современных технологий // Проблемы ветеринарной санитарии гигиены и экологии. – 2011. – №2 (6). – С. 16 – 17.
20. Эрнст Л.К. Биологические проблемы животноводства в XXI веке / Л.К. Эрнст, Н.А. Зиновьева. – М.: РАСХН, 2008. – С. 260-273.
21. Эрнст Л.К., Жигачева А.И. Кудрявцев В.А. «Мониторинг генетического груза в черно-пестрой, голштинской и айрширской породах крупного рогатого скота». Зоотехния, 2007, № 3, с. 5-10.
22. Полянская Н.А., Рейн А.Д. Кластеризация районов по параметрам конкурентоспособности и эффективности производства молока // Вестник НГИЭИ. 2015. № 11 (54). С. 79-85.13.
23. Яковлев А., Терлецкий В., Митрофанова О., Дементьева Н. Определение носителей генетических дефектов среди быков-производителей // Молочное и мясное скотоводство. – 2004. – № 7. – С. 31-32.

References


1. Agerholm J.S., Bendixen C., Arnbjerg J., Anderson O. Complex vertebral malformation in Holstein calves. J. Vet. Diagn. Invest. 2001. Vol.13. P.283-289.
2. Fletouris D.J. Determination of the marker residue of albendazole in milk using ion-pair liquid chromatography and fluorescence detection. D.J. Fletouris, N.A. Botsoglou, I.E. Psomas, A.I. Mantis. Analytica Chimica Acta. 1997. Vol. 345. P. 111-119.
3. Georges M., Massey J.M. Velogenetics, or the synergistic use of marker assisted selection and germ line manipulation Theriogenology. 1991. V. 35. P. 151-159.
4. Gerbens F. Characterization, chromosomal localization, and genetic variation of the porcine heart fatty acid-binding protein gene F. Gerbens, G. Rettenberger, J.A. Lenstra et al. Mamm. Genome. 1997. Vol. 8. P. 328-332.
5. Gilbert R.O., Rebhun W.C., Kim C.A., Kehrli M.E.Jr., Shuster D.E., Ackerman M.R. Clinical manifestations of leukocyte adhesion in cattle: 14 cases (1977-1991). J. Am. Vet. Med. Assoc. 1993. Vol. 202. No 3. P. 445-449.
6. Haley C.S., Visscher P.M. Strategies to utilize marker - quantitative trait loci associations J. Dair. Sci. 1998. V. 81. No 2. C. 85-97.
7. Kahle M. Kennzeichung des BLAD-Status weiblicher Tiere // Rind in Bild. 1994. No 2. P.20.
8. Kalashnikova L.A., Dunin I.M., Glazko V.I. Selection of XXI century: the use of DNA technologies. M.: VNII plem, 2001. P. 3-4.
9. Li Yan-hua, Han Guang-wen, Zhang Sheng-li, Li Ning, Sun Feng-jun. Detection of Bovine Leukocyte Adhesion Deficiency (BLAD) and Haplotype Analysis. Acta veter. zootechn. Sinica. 2008. Vol. 39. No 9. P.1285-1288.
10. Marron B.M., Robinson J.L., Gentry P.A., Beever J.E. Identification of a mutation associated with factor XI deficiency in Holstein cattle. Animal Genetics, 2004. V.35. P.454-456.
11. Medrano, J. F. Genotyping of bovine kappa-casein loci following DNA sequence amplification. J.F. Medrano, E. Aguilar-Cordova. Biotechnology. 1990. Vol. 8. P. 44-46.
12. Meuwissen T.H.E. Genomic selection: The future of animal breeding Norwegian University of LifSciences, Box 5003, 1432 As Norway, 2007. P. 88-91.
13. Pfeiffer I., Brennig B. Frequency of the canine leukocyte adhesion deficiency (CLAD) mutation among Irish red setters in Germany. J. Anim. Breed. Genet. 2005. Vol.122. P.140-142.
14. Qin Chu, Dongxiao Sun, Ying Yu, Yi Zhang and Yuan Zhang. Identification of complex vertebral malformation carriers in Chinese Holstein. J. Vet. Diagn. Invest. 2008. Vol.20. P. 228-230.
15. Rutten V.P.M.G., Hoek A., Muller K.E. Identification of monoclonal antibodies with specificity to α - or ß - chains of ß 2 integrins using peripheral blood leucocytes of normal and Bovine Leucocyte Adhesion Deficient (BLAD) in cattle Vet. Immun. Immunopathol. 1996. Vol. 52. P. 341-345.
16. Samusenko L., Himicheva S. Genotype of cows — the basis of milk quality. Milk and dairy products. Production and realization. 2012. No 2. P. 17–19.
17. Savva, D. Genetic characterization of an alloalbumin, albumin Kashmir, using gene amplification and allele-specific oligonucleotides. D. Savva, A.L. Tarnoky, M.F. Vickers. Biochemical J. 1990. Vol. 266. P. 615-617.
18. Serebrovsky A.S., Wassina E.T. On the topography of the sex-chromosome in fowis. J. Genet, 1926. V. 17. P. 211-216.
19. Size of native and heated casein micelles, content of protein and minerals in milk from Norwegian Red Cattle effect of milk protein polymorphism and different feeding regimes. T.G. Devold [et al.]. International Dairy J. 2000. Vol. 10. Р. 313-323.
20. Togashi, K. Overview of genetic evaluation in dairy cattle. K. Togashi, C.Y. Lin, K. Yokouchi. J. Animal Science. 2004. Vol. 75. P. 275-284.
21. Zsolnai A., Fesus L. Simultaneous analysis of bovine к-casein and BLAD alleles by multiplex PCR followed by parallel digestion with two restriction enzymes. Animal Genetics. 1996. Vol. 27. No 3. P. 207-209.
22. Poljanskaja N.A., Rejn A.D. Klasterizacija rajonov po parametram konkurentosposobnosti i jeffektivnosti proizvodstva moloka.Vestnik NGIJeI. 2015. No 11 (54). P. 79-85.13.
23. Jakovlev A., Terleckij V., Mitrofanova O., Dement'eva N. Opredelenie nositelej geneticheskih defektov sredi bykov-proizvoditelej. Molochnoe i mjasnoe skotovodstvo. – 2004. – No 7. – P. 31-32.

Возврат к списку