,

$ 66.44 75.63

Сельское хозяйство

Теоретическое и экспериментальное обоснование методов ДНК-анализа для оценки генетического материала голштинской породы КРС

Введение

Разведение различных пород КРС, включая голштинскую, является сложной системой, состоящей из зоотехнических, ветеринарных, зоогигиенических, ветеринарно-санитарных и других мероприятий. При этом необходимо учитывать генетические, физиологические, половые и возрастные характеристики животных, особенности их кормления, содержания, предрасположенность к болезням [22, 23]. Важным является регион разведения и особенности сельскохозяйственного производства (фермы, частные подворья, крупные племенные хозяйства) и другие факторы.

При разведении КРС существенную роль играют различные генетические аномалии. В племенном деле для корректирующей селекции важной проблемой является контроль генетических дефектов у крупного рогатого скота [Эрнст Л.К., Жигачева А.И. Кудрявцев В.А. «Мониторинг генетического груза в черно-пестрой, голштинской и айрширской породах крупного рогатого скота». Зоотехния, 2007, № 3, с. 5-10].

Среди этих дефектов следует отметить комплексную аномалию позвоночника КРС (CVM — Complex Vertebral Malformation). Это сложный тератологический синдром телят голштинской породы, проявляющийся, прежде всего, в абортах, преждевременных родах, мертворождении или смерти телят в первые дни жизни, а, значит, воздействующий на смертность молодняка и воспроизводительные способности скота. Возникновение данного синдрома обусловлено аутосомной рецессивной мутацией SLC35A3 — гена и явлением плейотропии, при котором этот ген вызывает резкие отклонения от нормального хода развития и множественные аномалии.

К другим, немаловажным генетическим дефекта, можно отнести дефицит лейкоцитарной адгезии КРС. Проявления заболевания — отставание в росте, воспаления лёгки, кишечного тракта, гортани, дёсен, частичное выпадение зубов. Заболевание является наследственным, аутосомно-рецессивным и сопровождается высокой чувствительностью к бактериальным и грибковым инфекциям.

Для объективной характеристики особей необходимо проводить их генетическую оценку  с применением современных методов и средств.

Для этих целей перспективными являются методы ДНК- анализа.

В настоящее время разработаны тест-системы на основе ПЦР в режиме реального времени (Real time PCR) для диагностики указанных выше генетических дефектов. Однако, для реализации ее для конкретных объектов, необходимо проводить валидацию и верификацию тест-системы.

Актуальным также является проведение оценки других методов ДНК-диагностики, в частности, ДНК-микрочиповой технологии и секвинирования с целью применения их при выяснении генетических дефектов КРС.

Целью нашей работы являлось проведение теоретического и экспериментального обоснования  методов ДНК-анализа для оценки генетического материала  голштинской породы КРС. В задачи исследования входило:

1. Провести выделение ДНК из крови и молока КРС и усовершенствовать методику выделения с помощью робототехники.

2. Валидировать и верифицировать тест-систему «CVM-BLAD» фирмы «Синтол» для определения комплексной аномалии позвоночника (CVM) и дефицита лейкоцитарной адгезии (BLAD) у крупного рогатого скота методом ПЦР в реальном времени.

3. Провести анализ данных по оценки генетического материала   голштинской породы КРС по определению комплексной аномалии позвоночника (CVM) и дефицита лейкоцитарной адгезии (BLAD).

4. Теоретически и экспериментально обосновать методы ДНК-чиповой  технологии для оценки генетического материала голштинской породы КРС.

Материал и методы

Исследования проводились на Зооинженерном факультете Российского Государственного Аграрного Заочного Университета (ФГБОУ ВО «РГАЗУ») под руководством доктора сельскохозяйственных наук, профессора А.С. Де-ляна, а также на базах Федерального государственного бюджетного научного учреждения «Всероссийский научно-исследовательский институт ветеринарной санитарии, гигиены и экологии» (ФГБНУ «ВНИИВСГЭ»), Всероссийского научно-исследовательского института животноводства Россельхозакаде-мии (ВИЖ  им. Л.К. Эрнста, ВНИИ животноводства).

В работе использовали набор реагентов фирмы «Синтол» для проведения ПЦР в режиме «реального времени» по определению сайтов ДНК «CVM-BLAD» для выявления сайтов ДНК комплексной аномалии позвоночника и дефицита лейкоцитарной адгезии у крупного рогатого скота.

Экспериментальные образцы ДНК-микрочиповой технологии (ФГБНУ «ВНИИВСГЭ»).

Матричную ДНК выделяли с помощью роботизированного прибора Qiagen EZ1 Advanced XL, использующего технологию магнитных частиц, термоциклир «Mastercycler epgradient S eppendorf realpleax2». 

Тест система «CVM-BLAD» и методика ПЦР в режиме «реального времени» по определению сайтов ДНК  комплексной аномалии позвоночника и дефицита лейкоцитарной адгезии у крупного рогатого скота.

Набор включал последовательности праймеров и аллель-специфических зондов, которые имеют следующую структуру: CVM_up gattctcaagagcttaattctaagga, CVM_low aagtaaaccccagcaaagccac, CVM_Wt (FAM)-aggtctcatggcagttct-(BHQ1), CVM_m (R6G)-catggcatttctcacagcat-(BHQ2), BLAD_up ttaggcagttgcgttc, BLAD_low acgttgacgaggtcatccacca, BLAD_Wt (ROX)-accccatcgacctgtacta-(BHQ1), BLAD_m (Cy5)-ccatcggcctgtactacct-(BHQ2). Предложенное изобретение позволяет одновременно диагностировать CVM и BLAD у крупного рогатого скота методом ПЦР в реальном времени, а также сократить время выполнения полимеразной цепной реакции в реальном времени.

Набор праймеров и зондов в сравнении со всеми изученными аналогами имеет следующие преимущества: специфическая структура праймеров и зондов, а также с помощью предлагаемого к патентованию набора праймеров и зондов можно одновременно в одной пробирке провести полимеразную цепную реакцию в режиме реального времени (ПЦР-РВ), что обеспечивает быстроту проведения диагностики и получение результата сразу по двум представленным мутациям.

Подбор праймеров и аллель-специфических зондов позволял при помощи пакета прикладных программ «Oligo 6.0» на основании анализа нуклеотидных последовательностей локусов SLC35A3 и CD 18 ДНК, опубликованных в базе NSBI.

Источником для проведения диагностики служила предварительно выделенная ДНК из образцов цельной крови и молока.

Результаты и обсуждение

В процессе исследований была выделен матричная ДНК из крови с использованием робототехники [1], что позволяло сократить время выделения и автоматизировать процесс.

Проведена валидация тест-системы и установлены оптимальные параметры постановки ПЦР РВ для используемого термоциклера «Mastercycler epgradient S eppendorf realpleax2». 

1. Удержание температуры 94°С — 3 мин, один повтор.

2. Циклирование 1

94°С — 25 с

61°С — 23 с

64°С — 23 с

Цикл повторяли 10 раз.

3. Циклирование 2 (с детекцией)

94°С – 25,0 с

61°С — 23 с

64°С — 30 с — детекция по каналам: Green, Yellow, Orange, Red

Цикл повторяли 30 раз.

Результатом анализа являлось определение мутантных аллелей, вызывающих комплекс аномалий позвоночника (CVM) и дефицит лейкоцитарной адгезии (BLAD) у крупного рогатого скота.

Аллель-специфические зонды эффективны при детекции CV и BL мутаций в исследуемом фрагменте генома. Для локуса с мутацией подбирают пару зондов, так чтобы один из них специфически гибридизовался при температуре проведения синтеза цепей с аллелем нормального (дикого) типа, а второй зонд — с аллелем мутантного типа.

Переход порога, характеристика количества копий ДНК отдельного гена, кривая располагалась между двумя пороговыми значениями 10 и 15 циклами амплификации.

Кривая без маркеров располагается между 10 и 15 циклами над красной пороговой линией. Вторая кривая с окружностями ниже пороговой линии. Данная ситуация характерна для здорового исследуемого животного.

Результаты исследования гетерозиготного животного или носителя мутантного CV аллеля обе кривые флуоресценции пересекали установленную на соответствующем уровне пороговую линию в обозначенном районе, между 10 и 15 циклами ПЦР-РВ.

Определение BL аллеля было аналогично, только регистрировалось по каналам Orange и Red. 

Исследования помогли выявить в трех процентах проб (всего 20) указанные генетические дефекты.

При использовании ДНК-чипов применяли ранее предложенный подход  [2] и разработана соответствующая тест- система и методика адаптированная к нашим объекта

ДНК-зонды предварительно получали в реакции амплификации с использованием выше указанных коммерческих праймеров и меченных биотином дезоксинуклеозидтрифосатами.

Выделение и очистку исследуемой ДНК проводили с помощью детергента «Silico», магнитосепарации при использовании робототехники.

 Выделенную ДНК иммобилизовали на мембранные фильтры и проводили гибридизацию с меченными ДНК-зондами.

Гибридизацию проводили с помощью тест-набора для гибридизации, который представлял собой комплект реагентов включавший: ДНК-зонд (№1), контрольный положительный образец (№2), контрольный отрицательный образец (№3), субстрат (№4), хромоген (№5), протеиназа К (№6), конъюгат (№7), раствор для гибридизации (№8), солевой раствор TS (№9), желатин 10% или сухой (№10), раствор для приготовления проявляющей смеси (№11), навеска солей для приготовления 20xССР (№12), блокирующий реагент (№13), раствор для лизиса (№14), лаурилсульфат натрия (SDS) 10% (№15), тритон Х-100 (№16), полиэтиленгликоль (№17), нитроцеллюлозный фильтр (№18).

ДНК-зонды гибридизовали с денатурированными иммобитлизованными ДНК. Не связавшиеся зонды удаляли путем отмыки чипа. На следующем этапе чип обрабатывали конъюгатом стрептавидина с щелочной фосфатазой. На заключительном этапе вносили субстратный раствор. Окрашивание соответствующих точек свидетельствовало о наличии искомой бактериальной ДНК в исследуемом материале.

Перед проведением реакции готовили рабочие растворы:

1. Раствор 20xССР. Содержимое флакона («Навеска солей для приготовления 20xССР») растворяли в 27.0 мл дистиллированной воды.

2. Раствор 10xССР. 10.0 мл раствора 20xСCР разводили в 10 мл дистиллированной воды и тщательно перемешивали.

3. Прегибридизационный раствор. К 3-м мл раствора для гибридизации добавляли 3 мл дистиллированной воды и 24 мкл раствора из микропробирки («Контрольный отрицательный образец»). Полученный раствор тщательно перемешивали.

4. Гибридизационный раствор. В 3-х мл прегибридизационного раствора растворяли содержимое флакона («Полиэтиленгликоль») и добавляли содержимое микропробирки («ДНК-зонд»), предварительно прогрев ее в кипящей водяной бане в течение 8 мин.

5. Отмывочный раствор №1. К 10 мл раствора 20xСCР добавляли 2 мл раствора из флакона («Лаурилсульфат натрия 10%») и разводили дистиллированной водой до конечного объема 100 мл. Полученный раствор тщательно перемешивали.

6. Отмывочный раствор № 2. К 1 мл раствора 20xССР добавляли 2 мл раствора из флакона («Лаурилсульфат натрия 10%») и разводили дистиллированной водой до конечного объема 100 мл. Полученный раствор тщательно перемешивали.

7. Отмывочный раствор №3. 2мл раствора 20xССР разводили дистиллированной водой до конечного объема 20 мл и тщательно перемешивали.

8. Лизирующий раствор. Добавляли содержимое пробирки («Протеиназа К») во флакон («Раствор для лизиса») и тщательно перемешивали.

9. Раствор TST. Содержимое двух флаконов («Солевой раствор TS») растворяли в 200 мл дистиллированной воды и добавляли 0.1 мл тритона Х-100.

10. Блокирующий раствор. Содержимое пробирки («Блокирующий реагент») разводили в 22 мл раствора ТST, добавляли 3 мл желатина 10% из ампулы или приготовленный из сухого желатина (1г желатина растворяли в 10 мл воды; для быстрого растворения раствор можно подогревать и тщательно перемешивать).

11. Раствор конъюгата. Из пробирки («Конъюгат») отбирали 0,002 мл раствора и вносили в 3 мл раствора TST. Поученный раствор тщательно перемешивали.

12. Для приготовления проявляющей смеси в 3 мл из флакона («Раствор для приготовления проявляющей смеси») добавляли 13,2 мкл из пробирки («Хромоген») и 9,9 мкл из пробирки («Субстрат»), (содержимое которой предварительно взмутить). Полученный раствор тщательно перемешивали.

На чип наносили ампликоны и 3 мл гибридизационного раствора. Инкубировали чип 4 часа при 65ºС в плотно закрытой чашке Петри.

Чип отмывали трехкратно по 10 мин на качалке при комнатной температуре в 30мл отмывочного раствора №1. Затем отмывали двукратно по 10 мин при температуре 65ºС в 40 мл отмывочного раствора №2. Затем отмывали однократно в течение 5 мин на качалке при комнатной температуре в 20 мл отмывочного раствора №3. Чип помещали в 25 мл блокирующего раствора и инкубировали 30 мин при 37ºС.

Для проведения реакции связывания конъюгата чип ополаскивали в 20 мл раствора TST и переносили в чашку Петри с парафильмом на дне. Наслаивали на чип сверху 3 мл раствора конъюгата и инкубировали в течение 30 мин при комнатной температуре. Чип отмывали трехкратно по 10 мин на качалке при комнатной температуре в 30 мл раствора TST и однократно – в 7 мл раствора проявляющей смеси.

Переносили чип в чашку Петри с настеленным на дно парафильмом и наслаивали сверху 3 мл проявляющей смеси. Чип инкубировали в темноте при 37ºС или при комнатной температуре в течение нескольких часов до появления окраски в пятне, содержащем контрольный положительный образец. Чип промывали в водопроводной воде для остановки проявления и высушивали.

Учет результатов проводили визуально путем сравнения интенсивности окраски пятен, содержащих анализируемый материал, с интенсивностью окраски пятна на чипе, содержащего контрольный положительный образец, которое окрашивалось в фиолетово-голубой цвет. Пятно, содержащее контрольный отрицательный образец, не окрашивалось или имело интенсивность окраски на уровне общего фона фильтра. Если эти условия не соблюдались, учет результатов не считался адекватным и тест требовал повторной постановки.

Результаты показали корреляцию с методикой ПЦР РВ.

Выводы

Проведенные исследования показали возможность анализируемых методов и тест-систем для выявления генетических дефектов голштинской породы КРС.